Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Shewanellaceae

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_2263 iscR -90 5.5 ATACTTGAGTGATTTACTAGGTTTT
SO_2263 iscR -65 6.4 ATACTTGACTGATTTACTCGGGTAT
SO_4619 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
SO_0324 ygbA -29 4.1 TTATCCGAGTCACAGACTAAGGTAT
SO_4302 dnrN -167 5.1 AATCTTGACTATTTTAGTCAAGATT
SO_1304 erpA -88 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella putrefaciens CN-32
Sputcn32_2150 iscR -66 6.4 ATACTTGACTAATTTACTCGGGTAT
Sputcn32_2150 iscR -91 4.3 TTACCTGAGTGTTTTAGTAGGACTT
Sputcn32_3663 ygbA -29 4.9 ATATCCGAGTAACTGACTAAGGTAT
Sputcn32_3794 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
Sputcn32_3576 dnrN -90 5.6 ATTCCTGAGTGTTTTAGTCGGGTTT
Sputcn32_1123 erpA -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp W3-18-1
Sputw3181_1861 iscR -91 4.3 TTACCTGAGTGTTTTAGTAGGACTT
Sputw3181_1861 iscR -66 6.4 ATACTTGACTAATTTACTCGGGTAT
Sputw3181_3804 ygbA -29 4.9 ATATCCGAGTAACTGACTAAGGTAT
Sputw3181_0119 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
Sputw3181_3715 dnrN -90 5.6 ATTCCTGAGTGTTTTAGTCGGGTTT
Sputw3181_3041 erpA -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp ANA-3
Shewana3_2281 iscR -90 5.4 ATACCTGAGTGTTTTACTAGGTTTT
Shewana3_2281 iscR -65 6.3 ATACTTGACTGAAATACTCGGGTAT
Shewana3_0397 dnrN -90 5.2 ATGCCCGACTAATTTAGTCAGGATT
Shewana3_3845 ygbA -29 4.4 TTATCCGAGTGACAGACTAAGGTAT
Shewana3_4003 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
Shewana3_3067 erpA -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp MR-4
Shewmr4_1738 iscR -90 5.6 ATACTTGAGTATTTTACTAGGGTTT
Shewmr4_1738 iscR -65 6.4 ATACTTGACTGAATTACTCGGGTAT
Shewmr4_3649 ygbA -29 4.4 TTATCCGAGTGACAGACTAAGGTAT
Shewmr4_3804 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
Shewmr4_0398 dnrN -90 5.2 ATGCCCGACTAATTTAGTCAGGATT
Shewmr4_2889 erpA -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella sp MR-7
Shewmr7_1818 iscR -90 5.4 ATACTTGAGTGTTTTACTAGGTTTT
Shewmr7_1818 iscR -65 6.4 ATACTTGACTGAAATACTCAGGTAT
Shewmr7_0295 ygbA -29 4.4 TTATCCGAGTGACAGACTAAGGTAT
Shewmr7_3880 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
Shewmr7_3627 dnrN -90 5.2 ATGCCCGACTAATTTAGTCAGGATT
Shewmr7_2971 erpA -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella baltica OS155
Sbal_2398 iscR -90 5.4 ATACTTGAGTGTTTTAGTAGGTTTT
Sbal_2398 iscR -64 6.4 ATACTTGACTGATTTACTCGGGTAT
Sbal_0142 nfuA -46 5 AATTCTTACTAAAACACTCAGGTAT
Sbal_1163 erpA -64 5.7 ATACTTGAACAAAACAGTCAGGTAA
Sbal_4067 ygbA -29 4.5 ATATCCGAGTGACAAGCTAAGGTAT
Sbal_3989 dnrN -89 5.2 AATCCTGAGTATTTTAGTCGGGTTT
Shewanella denitrificans OS217
Sden_1457 iscR -88 5.1 ATACTTGAGTAAAACACTAGGTTTA
Sden_1457 iscR -63 6.4 ATACTTGACTAAATTACTCGGGTAT
Sden_3528 nfuA -46 5.4 GTATCTTACTAAATTACTCAGGTAT
Sden_2815 erpA -62 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella frigidimarina NCIMB 400
Sfri_2425 iscR -89 4.5 ATACCCGAGTGTTTTGGTAGGATTA
Sfri_2425 iscR -64 6.2 ATACTTGACTAAATTACTAGGGTAT
Sfri_0404 ygbA -43 5.6 ATATCCGACTGTTTTACTAAGGTAT
Sfri_0244 nfuA -46 5.1 AATTCTTACTAATTTACTCAGGTAT
Sfri_2976 erpA -63 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella amazonensis SB2B
Sama_1292 iscR -91 5.6 ATACTTGAGTAAATTAGTTGGTTTT
Sama_1292 iscR -66 6.5 ATAGTTGACTAAATTACTCAGGTAT
Sama_3326 ygbA -30 5.1 AAAACCAAGTAAATTACTTGGGTAT
Sama_3502 nfuA -44 4.7 AATTCTTAGTAATTTACTCAGGTTT
Sama_3236 dnrN -87 4.8 TTAACCCAGCAAAATACTCAAGTTT
Sama_0843 erpA -64 5.8 ATACTTGAACAAAATAGTCAGGTAA
Shewanella loihica PV-4
Shew_2318 iscR -65 6.4 ATACTTGACTAAAACAGTCAAGTAT
Shew_2318 iscR -90 5.1 ATACCTGACTAATCTGCTAGGTTTT
Shew_0106 nfuA -46 4.5 AATTCTTACTAAATCACTCGGGTTT
Shew_0259 ygbA -28 4.8 ATAACCCAGTAAAGAAGTCAGATAT
Shew_0328 dnrN -99 5.1 AATCCCGAGTAAAACACTCAAGTTT
Shew_1017 erpA -64 5.8 TTACTTGAACAAAATAGTCAGGTAT
Shewanella pealeana ATCC 700345
Spea_1487 iscR -65 6.4 ATACTTGACTAAAATAGTCGGGTAT
Spea_1487 iscR -90 5 ATACTTGACCGAATTGCTAGGCTTT
Spea_0383 dnrN -102 5.8 TTAACTGAGTATTTTACTCAAGTAA
Spea_0303 ygbA -28 5 ATAACCAAGTAGCTTACTAAGGTAT
Spea_4010 nfuA -47 4.5 AATTCTTACTAAAACACTCAGGTTT
Spea_0985 erpA -64 5.7 TTACTTGAACAAAACACTCAGGTAT
Shewanella halifaxensis HAW-EB4
Shal_1571 iscR -90 4.5 ATACCTGACCAAATAGCTAGGCTTA
Shal_1571 iscR -65 6 ATACTTGACTGAAACGGTCGGGTAT
Shal_3986 ygbA -28 5.1 ATAACCCAGTAACTTACTAAGGTAT
Shal_0247 nfuA -47 4.5 AATTCTTACTAAAACACTCAGGTTT
Shal_3908 dnrN -104 5.7 TTACTTGAGCATTTTACTCAGGTAA
Shal_1036 erpA -64 5.7 TTACTTGAACAAAACACTCAGGTAT
Shewanella piezotolerans WP3
swp_1693 iscR -90 5.2 ATACTTGACCAAACCACTAGGTTAA
swp_1693 iscR -65 6.5 ATACTTGACTAAATTACTCAGGTAT
swp_2171 ygbA -28 4.8 ATAACCCAGTGGCTTACTAAGGTAT
swp_4841 nfuA -48 4.5 AATTCTTACTAAAACACTCAGGTTT
swp_0412 dnrN -88 5.5 TTACCCGAGCATTTTACTCAACTAA
swp_3849 erpA -64 5.4 TTACTTGAACAAAACGGTCAGGTAT
Shewanella sediminis HAW-EB3
Ssed_2872 iscR -161 4.5 ATACCCCACCAAAGTGGCAGGGTAT
Ssed_2872 iscR -63 6.4 ATACTTGACTAAAATAGTCGGGTAT
Ssed_4199 ygbA -125 5.4 GTACCTTAGTAATTTACTAGGGTAT
Ssed_0179 nfuA -47 4.3 AATCCATACTAAAACACTCAAGCAT
Ssed_4124 dnrN -98 5.6 ATTCCTGAGCAATTTAGTCAAGTTT
Ssed_1095 erpA -64 5.5 TTACTTGAACAAAATGGTCAGGTAT
Shewanella woodyi ATCC 51908
Swoo_1775 iscR -215 4.1 TTTCGTGAGTATTATGGTAAAGATT
Swoo_1775 iscR -90 5.1 ATACTTGACTAAACTACTAGGTTTA
Swoo_1775 iscR -65 6.4 ATACTTGACTAAAACACTCAGGTAT
Swoo_0159 nfuA -46 4.4 AATCCATACTAAAACACTCAAGTTT
Swoo_0492 dnrN -97 5.4 TTACCCTAGTGTTTTAGTCGGGAAT
Swoo_1203 erpA -64 5.8 ATACTTGAACAAAATGGTCAGGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD