Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Shewanellaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO0096 hutC -131 6.1 TTACTTGTATATACAAGCTA
SO0095 hutI -95 6.5 TAGCTTGTATATACAAGTAA
SO0095 hutI -85 4.5 ATACAAGTAAATACAAGCTA
SO0096 hutC -141 5.6 TAGCTTGTATTTACTTGTAT
Shewanella putrefaciens CN-32
Sputcn32_0077 hutI -86 4.4 ATACAAGTAAATACAAGCCA
Sputcn32_0077 hutI -96 6.5 TAGCTTGTATATACAAGTAA
Sputcn32_0078 hutC -168 5.5 TGGCTTGTATTTACTTGTAT
Sputcn32_0078 hutC -158 6.1 TTACTTGTATATACAAGCTA
Shewanella sp W3-18-1
Sputw3181_4000 hutI -86 4.4 ATACAAGTAAATACAAGCCA
Sputw3181_4000 hutI -96 6.5 TAGCTTGTATATACAAGTAA
Sputw3181_3999 hutC -168 5.5 TGGCTTGTATTTACTTGTAT
Sputw3181_3999 hutC -158 6.1 TTACTTGTATATACAAGCTA
Shewanella sp ANA-3
Shewana3_0099 hutC -122 6.1 TTACTTGTATATACAAGCTA
Shewana3_0099 hutC -132 5.6 TAGCTTGTATTTACTTGTAT
Shewana3_0098 hutI -85 4.5 ATACAAGTAAATACAAGCTA
Shewana3_0098 hutI -95 6.5 TAGCTTGTATATACAAGTAA
Shewanella sp MR-4
Shewmr4_0097 hutI -85 4.3 ATACAAGTAAATACAAGCTG
Shewmr4_0098 hutC -132 5.4 CAGCTTGTATTTACTTGTAT
Shewmr4_0098 hutC -122 6.1 TTACTTGTATATACAAGCTA
Shewmr4_0097 hutI -95 6.5 TAGCTTGTATATACAAGTAA
Shewanella sp MR-7
Shewmr7_0093 hutC -132 5.6 TAGCTTGTATTTACTTGTAT
Shewmr7_0092 hutI -95 6.5 TAGCTTGTATATACAAGTAA
Shewmr7_0092 hutI -85 4.5 ATACAAGTAAATACAAGCTA
Shewmr7_0093 hutC -122 6.1 TTACTTGTATATACAAGCTA
Shewanella baltica OS155
Sbal_4254 hutI -96 6.5 TAGCTTGTATATACAAGTAA
Sbal_4254 hutI -86 4.5 ATACAAGTAAATACAAGCTA
Sbal_4253 hutC -167 5.6 TAGCTTGTATTTACTTGTAT
Sbal_4253 hutC -157 6.1 TTACTTGTATATACAAGCTA
Shewanella denitrificans OS217
Sden_0081 hutI -90 5.6 TACCTTGTATATACAAGCCA
Sden_0082 hutC -86 5.7 TGGCTTGTATATACAAGGTA
Shewanella frigidimarina NCIMB 400
Sfri_3955 hutI -70 5.9 TACCTTGTATATACAAGTTA
Sfri_3955 hutI -60 3.9 ATACAAGTTAAAACAAGTAT
Sfri_3954 hutC -57 4.6 ATACTTGTTTTAACTTGTAT
Sfri_3954 hutC -47 5.8 TAACTTGTATATACAAGGTA
Shewanella amazonensis SB2B
Sama_0080 hutI -135 3.4 ATACAAGTAGATACTGGCTG
Sama_0080 hutI -145 6.3 AAACTTGTATATACAAGTAG
Sama_0081 hutC -89 6.2 CTACTTGTATATACAAGTTT
Sama_0081 hutC -99 4 CAGCCAGTATCTACTTGTAT
Shewanella loihica PV-4
Shew_3759 hutI -85 6.5 TAGCTTGTATATACAAGTAA
Shew_3759 hutI -75 4.5 ATACAAGTAAATACAAGCTA
Shew_3758 hutC -128 5.6 TAGCTTGTATTTACTTGTAT
Shew_3758 hutC -118 6.1 TTACTTGTATATACAAGCTA
Shewanella pealeana ATCC 700345
Spea_4171 hutI -87 3.9 ATACAAGTAAACACAAGCTA
Spea_4170 hutC -96 5.3 TAGCTTGTGTTTACTTGTAT
Spea_4170 hutC -86 6.1 TTACTTGTATATACAAGCTA
Spea_4171 hutI -97 6.5 TAGCTTGTATATACAAGTAA
Shewanella halifaxensis HAW-EB4
Shal_0071 hutI -99 4.1 ATACAAGTAAATACAAGCGG
Shal_0071 hutI -109 6.5 TAGCTTGTATATACAAGTAA
Shal_0072 hutC -96 5 CCGCTTGTATTTACTTGTAT
Shal_0072 hutC -86 6.1 TTACTTGTATATACAAGCTA
Shewanella piezotolerans WP3
swp_0131 hutI -98 4.5 ATACAAGTAAATACAAGCTA
swp_0131 hutI -108 6.5 TAGCTTGTATATACAAGTAA
swp_0132 hutC -167 5.6 TAGCTTGTATTTACTTGTAT
swp_0132 hutC -157 6.1 TTACTTGTATATACAAGCTA
Shewanella sediminis HAW-EB3
Ssed_4449 hutI -75 4.6 ATACAAGTAAATACAAGTTG
Ssed_4449 hutI -85 6.5 TAGCTTGTATATACAAGTAA
Ssed_4448 hutC -140 5.4 CAACTTGTATTTACTTGTAT
Ssed_4448 hutC -130 6.1 TTACTTGTATATACAAGCTA
Shewanella woodyi ATCC 51908
Swoo_4840 hutI -85 4.6 ATACAAGTAAATACAAGTTG
Swoo_4840 hutI -95 6.5 TAGCTTGTATATACAAGTAA
Swoo_4839 hutC -191 5.4 CAACTTGTATTTACTTGTAT
Swoo_4839 hutC -181 6.1 TTACTTGTATATACAAGCTA
Swoo_4838 hutU -110 5.4 AGTGTTGTATATACAAGTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD