Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Sphingobacteria

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Sphingobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chitinophaga pinensis DSM 2588
Cpin_0606 PF00293 -83 6.6 TTTGTGTAAAAATTACGGAAA
Cpin_0606 PF00293 -31 6.6 TTTGTGTAACAAATACACAAA
Cytophaga hutchinsonii ATCC 33406
CHU_2422 prs -52 6.9 TTTGCGTAATTTTTACACAAA
CHU_2422 prs -1 6.8 ATTGCGTAATAATTACACAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD