Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Flavobacteria

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Flavobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Flavobacterium johnsoniae UW101
Fjoh_0755 prs -31 7 TTTGCGTATAATTAACGCAAA
Fjoh_0755 prs -83 6.7 TTTGCGTAATTTTTACACAAA
Kordia algicida OT-1
KAOT1_16118 prs -22 5.9 TTTGCGTACAAATAACGCTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD