Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Nocardiaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Nocardiaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodococcus opacus B4
ROP_15920 pnuC -30 5.3 TTGTAGTCACTACGACTACAA
ROP_15920 pnuC -64 5.2 TTGTAGTCATATCGACTACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD