Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Streptomycetaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_6513 nrtR1 -68 5.4 TATTGGTCGAAGTGACTATTA
SAV_6513 nrtR1 -84 5.4 TTATAGTCGAGATGACTATTG
SAV_2447 nrtR2 -31 4.9 TTATCGTCAGGCAGACGACTA
SAV_5948 nadE -31 4.6 ATCGTGTCGCTTTGACGATTA
SAV_2321 orfX -42 5.6 TTATCGTCGTAGTGACGAAAA
SAV_2321 orfX -76 4.5 ATTTCGTCCCCTTGACGATAA
Streptomyces coelicolor A3(2)
SCO1767 nrtR1 -36 6.4 TTATAGTCGCAGTGACTATTA
SCO2238 nadE 41 4.4 ATTGCGTCGTTCTGACGATTA
Streptomyces griseus subsp. griseus NBRC 13350
SGR_5730 pnuC -11 6.4 TTATAGTCAGAGTGACTATTA
SGR_5258 nadE -32 4.4 ATCGCGTCAGAAAGACGATTA
SGR_831 orfX -37 4.8 TTATCGTCGCCATGACGAAAT
SGR_1704 nrtR2 -31 4.9 TTATCGTCAGGCAGACGACTA
SGR_831 orfX -70 6 TAATAGTCACCTTGACTCTAA
Streptomyces scabiei 87.22
SCAB_71891 nrtR1 -52 6.2 TTATAGTCGTTCTGACTATTA
SCAB_24481 nrtR2 -31 4.9 TTATCGTCAGGCAGACGACTA
SCAB_66451 nadE -31 5 ATAATGTCGCTCTGACGATTA
SCAB_23161 orfX -59 5.5 TTATCGTCTGAGTGACACTAA
SCAB_23161 orfX -92 4.7 ATCTCGTCCCCTTGACGATAA
SCAB_71891 nrtR1 -36 5.5 TATTAGTCATGGTGACCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD