Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Micrococcineae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_3478 nrtR2 -56 6.2 TTATCGTCAACTTGACGATAA
AAur_3479 PF01145 -42 6.2 TTATCGTCAAGTTGACGATAA
AAur_3478 nrtR2 -11 5.9 TTATTGTCAAGATGACGATAA
AAur_3479 PF01145 -87 5.9 TTATCGTCATCTTGACAATAA
AAur_2535 nrtR -59 5.7 TTCTAGTCAACATGACTTTAA
Arthrobacter chlorophenolicus A6
Achl_2298 nrtR -78 5.5 TTTGAGTCAAGTTGACTATAA
Arthrobacter sp. FB24
Arth_2561 nrtR -101 5.9 TTCTAGTCATGTTGACTATAA
Beutenbergia cavernae DSM 12333
Bcav_2777 nrtR -42 4.3 ATAAGGTCACGTTCACCTTTA
Bcav_2777 nrtR -71 4.8 TTAGGGTTGAGTCGACTCTAA
Brachybacterium faecium DSM 4810
Bfae_03740 nrtR -72 4.7 TTCTGGTCACCGTGAGACTAA
Bfae_03740 nrtR -36 5.6 TAAAGGTCAACGCGACTTTAA
Kocuria rhizophila DC2201
KRH_00470 nrtR -80 5.7 TTAGTGTCACAGTGACTTTTA
Renibacterium salmoninarum ATCC 33209
RSal33209_1516 nrtR -11 6.3 TTAAAGTCAAAATGACTATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD