Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR in Shewanellaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Regulog: GntR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella baltica OS155
Sbal_4087 gntK -30 5.7 GTAGGTTACCGGTAACATGT
Sbal_4087 gntK -16 5.6 ACATGTTACCCGTAATATGA
Sbal_4088 gntU -74 5.6 TCATATTACGGGTAACATGT
Sbal_4088 gntU -60 5.7 ACATGTTACCGGTAACCTAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD