Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhnR1 in Psychromonadaceae/Aeromonadales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Regulog: PhnR1 - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_3983 phnS -294 5.9 TTGCTGGAGTAGTCCAGCTT
AHA_3983 phnS -152 5.6 TAACTGACCTAGTCCAGAGG
AHA_3982 null -218 5.6 CCTCTGGACTAGGTCAGTTA
AHA_3982 null -76 5.9 AAGCTGGACTACTCCAGCAA
Aeromonas salmonicida subsp. salmonicida A449
ASA_4029 phnS -26 5.6 TAACTGACCTAGTCCAGAGG
ASA_4029 phnS -167 5.7 CCGCTGGAGTAGACCAGCGT
ASA_4028 null -223 5.6 CCTCTGGACTAGGTCAGTTA
ASA_4028 null -82 5.7 ACGCTGGTCTACTCCAGCGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD