Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CD1503 in Clostridia-2

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: CD1503 - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium bartlettii DSM 16795
CLOBAR_01627 CD1503 -45 7.3 TATGGTTAATTACTTGAGTAACTAACTATA
Clostridium difficile 630
CD1503 CD1503 -47 6.8 TATAGTTAATTAGTTGAGTAACTAACTAAT
Clostridium hiranonis DSM 13275
CLOHIR_01288 CD1503 -68 6.3 AGGAGTTAGTTACTTGACTAACTAACCAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD