Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CBO1205 in Clostridia-1

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux; Macrolides efflux
Effector:
Regulog: CBO1205 - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium botulinum A str. ATCC 3502
CBO1205 CBO1205 -50 6.6 TATAGTTAGTCATATAAGTAATTAACCAAC
Clostridium tetani E88
CTC01688 null -39 6 TATACTTAGTTATATTAGTAACTAACCAAT
CTC01397 lp_2744 -94 6.7 TATAGTTAGTTATACATGTAACTAACCAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD