Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BC2903 in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: BC2903 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus cereus ATCC 14579
BC2903 BC2903 -228 7 TATGGTTAATTACATAAGTAATGAACCTAT
BC2904 BC2903 -50 7 TATGGTTAATTACATAAGTAATGAACCTAT
Bacillus clausii KSM-K16
ABC0622 BC2903 -89 6.1 TATGGTTAACTACATAACCAGCTAACCAAA
ABC3409 BC2903 -52 6.2 TATAGTTGATTACACTACTAATCAACCAAT
Bacillus halodurans C-125
BH3492 BC2903 -39 7.2 TATGGTTAGTTACATAAGTAATGAACCAAG
Oceanobacillus iheyensis HTE831
OB0429 BC2903 -62 5.5 TATAGTTATACACATGAGTATATAACCGTA
OB0885 BC2903 -46 7.3 TATGGTTAGTTACATAAGTAATTAACCAAT
Paenibacillus sp. JDR-2
Pjdr2_5967 BC2903 -58 6.7 TATAGTTGATTACATGAGTAACCAACCACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD