Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GalR in Shewanellaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella woodyi ATCC 51908
Swoo_2083 galR -18 4.9 TAATGTAAACGTTATCTTAT
Swoo_2084 galT2 -51 5.8 AAATGGAAACGTTTACATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD