Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Csac_2166 in Thermoanaerobacterales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Csac_2166 - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anaerocellum thermophilum DSM 6725
Athe_0959 THA_1504 -50 7.5 AGTGTTATATAATTATATAACACT
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_2166 Csac_2166 -50 7.5 AGTGTTATATAATTATATAACACT
Carboxydothermus hydrogenoformans Z-2901
CHY_0445 Csac_2166 -50 7.1 ACTGTTATATAATTATATAACAGC
Thermoanaerobacter ethanolicus X514
Teth514_0375 THA_1504 -47 7.4 AGTGTTATATAATTATATAACAGT
Thermoanaerobacter tengcongensis MB4
TTE0439 THA_1504 -49 7.2 ACTGTTATATTATTATATAACAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD