Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ELI_12480 in Sphingomonadales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: ELI_12480 - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erythrobacter litoralis HTCC2594
ELI_11155 ELI_11155 -49 4.4 TCGTGTCTTAGACACCTAATACAGTT
ELI_02675 pbp -28 4.1 CGCTGTGTTATCCTGCTAATACAGCC
ELI_13485 rndA -55 4.5 AGGTGACTTATATAGGTAATACAGCG
ELI_12480 ELI_12480 -26 4.4 CGGTGTATTATGGCACTGAAGCACCC
Erythrobacter sp. NAP1
NAP1_15423 null -60 4.9 AGGCGCTTTACACAAGTAACACACCA
NAP1_15233 ELI_11155 -90 4.9 GCGTGTTTTAGATCACTAATACAGTA
NAP1_01960 pbp -30 4.1 GGCTGTATTAGGCTGCTAACACAGTG
NAP1_12603 rndA -73 4.4 GGGTGACTTATACGTATAACACACTT
NAP1_13568 ELI_12480 -41 3.8 GGCTGTATTATGGCACTGAAGCACCT
Novosphingobium aromaticivorans DSM 12444
Saro_2959 ELI_11155 -49 4.3 CGCTGTGTTGCGTGTATAAGACAGCT
Saro_0164 ELI_12480 22 4.3 GGCTGTATTATGGCAATATAGCACCC
Saro_0040 rndA -81 4.7 AAGTGTGTTATATGTATAGCACGCTA
Sphingobium japonicum UT26S
SJA_C1-07830 ELI_11155 -55 4.4 AACTGTTCTATACGCATATAACAGTT
SJA_C1-22810 pbp -25 4.1 GACCGTGTCAGGCAAATAACACAGCA
SJA_C1-02860 rndA -63 5.2 GGGTGATGTATTCATATAATACAGCA
SJA_C1-23280 ELI_12480 -25 4.3 CGCTGTATTATGGCACTGATGCACCA
Sphingopyxis alaskensis RB2256
Sala_2308 ELI_11155 -85 4.7 CAGTGTAATGCTTGTATAATACAGTG
Sala_1453 pbp 1 3.8 TGCTGTGTTGGGGTTGTAATACGGCC
Sala_0471 rndA -100 4.9 CGGTGATTTAATTAGGTAATACACCT
Sala_0952 ELI_12480 -25 4.7 TGCTGTCTTATGGCATTAAGTCGCCA
Sphingomonas wittichii RW1
Swit_0261 ELI_11155 -72 3.3 CGCCGTATCGCTTGAATAATGCACCC
Swit_4745 rndA -70 4.2 AGGTGACGTATTGAGATAATACAGCT
Swit_0076 ELI_12480 -25 4.8 TGCTGTGTTAGCACAGTGTGACGCCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD