Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CPS_0449 in Alteromonadales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: CPS_0449 - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Colwellia psychrerythraea 34H
CPS_0449 CPS_0449 -58 6 CGGTGTGCTAGTGATGTATAACACTA
Pseudoalteromonas tunicata D2
PTD2_20187 CPS_0449 -61 4.8 TGGTGTGCTGGTGATGTATAACACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD