Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CD0652 in Clostridia-2

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: CD0652 - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium difficile 630
CD2023 CD0652 -48 7.4 TTTATATAATGTGTATATACTATATATACAATTTAAGGA
CD0652 CD0652 -60 5.2 AGTGTATAGTGTGTATATAATAACATCACACTGAAAATG
Clostridium hiranonis DSM 13275
CLOHIR_00432 CD0652 -104 6.5 TGTATATAGTGTATATACAGTTGACAGAATTTATATACA
CLOHIR_00432 CD0652 -115 6.6 TTAAAAAATTGTGTATATAGTGTATATACAGTTGACAGA
CLOHIR_00432 CD0652 -63 7 GTTATTATGTGTATATAGATAATATATACAGTATATACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD