Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cbei_4343 in Clostridia-1

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Cbei_4343 - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_4343 Cbei_4343 -60 8.8 TGTTCATACTGTATATATTGTATATATACAGTATGAACA
Clostridium botulinum A str. ATCC 3502
CBO2918 Cbei_4343 -61 8.2 AACACATACTGTATATATTATATATATACAGTATGTACG
CBO2066 Cbei_4343 -55 6 TGTGTATAGTGTGTATTGTACATATACACACTGATTATG
Clostridium kluyveri DSM 555
CKL_0385 Cbei_4343 -51 8.2 TGTGAACATTGTATATATTATATATATACAATGTTCACA
Clostridium novyi NT
NT01CX_2435 Cbei_4343 -54 9.2 TGTATATACTGTATATAAAGAATATATACAGTATATACA
Clostridium perfringens ATCC 13124
CPF_0445 Cbei_4343 -56 9.3 TGTATATACTGTATATATAGAATATATACAGTATATACA
Clostridium tetani E88
CTC00804 Cbei_4343 -55 8.7 TGTATATACTGTATATATACGATATGCACAGTATATACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD