Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Csac_2497 in Thermoanaerobacterales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Csac_2497 - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anaerocellum thermophilum DSM 6725
Athe_0118 Csac_2497 -45 6.2 TGTATATACTGTATATATACAGTATGCAAAAGGAGAAAG
Athe_0118 Csac_2497 -54 7.6 AATTAAAACTGTATATACTGTATATATACAGTATGCAAA
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_2497 Csac_2497 -45 6.1 TGTATATACTGTATATATACAGTATGCAAAAGGGGAAAG
Csac_2497 Csac_2497 -54 7.6 AATTAAAACTGTATATACTGTATATATACAGTATGCAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD