Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BH0651 in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: BH0651 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus cereus ATCC 14579
BC4222 BH0651 -55 8.9 TGTATATACTGTATATATAAGGTATATACAGTATATACA
Bacillus clausii KSM-K16
ABC0260 BH0651 -306 7 TGTATATGATGGGCATATAGTATATATACATTATATGAA
ABC3528 BH0652 -195 7.6 CGTTATTTTTGTATATATATGATATATACAATATGAACA
ABC3528 BH0652 -186 7 TGTATATATATGATATATACAATATGAACAAAATATACA
Bacillus halodurans C-125
BH0651 BH0651 -157 8.7 TGTATATAATGTATATATAGTATATATACATTATATAAA
Bacillus licheniformis DSM 13
BLi00208 BH0651 -53 7.5 TGTGTATATTGTACATATTGTGTATATTGTATATAAACA
BLi02114 BH0651 -58 7 TGTTATAACTGTTTATATTGTATATATACAGTTATAACG
Bacillus pumilus SAFR-032
BPUM_0174 BH0651 -73 8.4 TGTATATAATGTATATATAGTATATATACAATATTTTGT
Paenibacillus sp. JDR-2
Pjdr2_3954 BH0652 -49 5.9 GTGATATATTGTGTATACACGACATACACAATTTGATCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD