Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ABC3918 in Bacillales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog: ABC3918 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus clausii KSM-K16
ABC3919 ABC3919 -52 7.3 AATACTGTGTATGTAGATATAAACAGATGA
Bacillus halodurans C-125
BH1163 ABC3919 -49 7.3 TATACTGTGTATATAGATATTAACACATAA
Paenibacillus sp. JDR-2
Pjdr2_5298 ABC3919 -59 7.9 TATACTGTGTATAAGGATATACACAGTATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD