Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PdxR3 in Streptomycetaceae

Properties
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_6929 COG2364 9 5.5 AGTCCACCTTCCCGGAATTGGCCA
SAV_980 pdxR3 -25 3.8 TAGCCAGATTGGCTAGGCTGGTTC
SAV_6928 pdxR3 -31 5.5 TGGCCAATTCCGGGAAGGTGGACT
SAV_7578 COG2364 -129 3.8 GAACCAGCCTAGCCAATCTGGCTA
Streptomyces coelicolor A3(2)
SCO1418 COG2364 -95 5.6 AGTCCACCTTCCCCAAATTGGCCA
SCO1417 pdxR3 -31 5.6 TGGCCAATTTGGGGAAGGTGGACT
Streptomyces griseus subsp. griseus NBRC 13350
SGR_4327 COG2364 -129 3.8 GGACCAGCGTAGCCAATCTGGCTA
SGR_4328 pdxR3 -25 3.8 TAGCCAGATTGGCTACGCTGGTCC
SGR_6114 COG2364 -95 5 AGTCCACCTTCCTCGAATTGGCCA
SGR_6115 pdxR3 -31 5 TGGCCAATTCGAGGAAGGTGGACT
Streptomyces scabiei 87.22
SCAB_75881 pdxR3 -30 5.3 TGGCCAATTCGGGGAAGGTGGACT
SCAB_75871 COG2364 -92 5.3 AGTCCACCTTCCCCGAATTGGCCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD