Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SCO3812 in Streptomycetaceae

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux
Effector:
Regulog: SCO3812 - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces coelicolor A3(2)
SCO3812 SCO3812 -22 5.5 TGGTGATAGTTTCATTAGCACCA
Streptomyces griseus subsp. griseus NBRC 13350
SGR_2260 SCO3813 -116 5.5 TTGTTCTACTAGCATGCGAACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD