Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR2 in Various betaproteobacteria

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromobacterium violaceum ATCC 12472
CV3051 fruR2 -155 4.9 CATTGAAAACGATTACATTT
CV3051 fruR2 -22 4.4 AATTGAAAACGATTTCTCAG
CV3052 fruB -186 4.4 CTGAGAAATCGTTTTCAATT
CV3052 fruB -53 4.9 AAATGTAATCGTTTTCAATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD