Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR2 in Comamonadaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_4253 fruR2 -206 4.3 ATTTGGTATCGATTCCAGAC
Aave_4253 fruR2 -16 4 TCATGGAATCGTTACCATGC
Aave_4252 fruB -225 4 GCATGGTAACGATTCCATGA
Aave_4252 fruB -35 4.3 GTCTGGAATCGATACCAAAT
Delftia acidovorans SPH-1
Daci_2662 fruR2 -127 5.2 TTTTGGGAACGTTCCCAACC
Daci_2662 fruR2 -17 4.5 CAACGGGAACGATTGCATTG
Daci_2663 fruB -108 4.5 CAATGCAATCGTTCCCGTTG
Daci_2663 fruB 2 5.2 GGTTGGGAACGTTCCCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD