Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Shewanellaceae

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_1689 copA -65 6.5 ACTCTCCCGTGATGGGAGACT
Shewanella putrefaciens CN-32
Sputcn32_1407 cueR -86 6.5 AGTCTCCCATCACGGGAGAGT
Sputcn32_1408 copA -65 6.5 ACTCTCCCGTGATGGGAGACT
Shewanella sp W3-18-1
Sputw3181_2694 cueR -86 6.5 AGTCTCCCATCACGGGAGAGT
Sputw3181_2693 copA -65 6.5 ACTCTCCCGTGATGGGAGACT
Shewanella sp ANA-3
Shewana3_2762 cueR -92 6.5 AGTCTCCCATCACGGGAGAGT
Shewana3_2761 copA -65 6.5 ACTCTCCCGTGATGGGAGACT
Shewanella sp MR-4
Shewmr4_2588 cueR -104 6.5 AGTCTCCCATCACGGGAGAGT
Shewmr4_2587 copA -65 6.5 ACTCTCCCGTGATGGGAGACT
Shewanella sp MR-7
Shewmr7_2655 cueR -104 6.5 AGTCTCCCATCACGGGAGAGT
Shewmr7_2654 copA -65 6.5 ACTCTCCCGTGATGGGAGACT
Shewanella baltica OS155
Sbal_1504 cueR -105 6.2 AGTCTCCCATTGCGGGAGAGT
Sbal_1505 copA -65 6.2 ACTCTCCCGCAATGGGAGACT
Shewanella denitrificans OS217
Sden_3691 copA -61 5.1 ACCTTACCATGATGGCAAGCT
Shewanella amazonensis SB2B
Sama_1786 copA -67 5.5 ACCTTCCCATAATGGCAAGGT
Sama_1787 copZ -114 5.5 ACCTTGCCATTATGGGAAGGT
Shewanella pealeana ATCC 700345
Spea_2772 copA -63 5.1 ACTCTCCCCCTGTAGGAGACA
Spea_2773 cueR -57 5.1 TGTCTCCTACAGGGGGAGAGT
Shewanella halifaxensis HAW-EB4
Shal_2867 copA -62 6 ACTCTCCCCTTATGGGAGACA
Shal_2868 cueR -81 6 TGTCTCCCATAAGGGGAGAGT
Shewanella piezotolerans WP3
swp_3377 copA -73 6 ACTCTCCCCTTATGGGAGACA
swp_3378 cueR -58 6 TGTCTCCCATAAGGGGAGAGT
Shewanella sediminis HAW-EB3
Ssed_1484 cueR -81 6 TGTCTCCCCTAATGGGAGAGT
Ssed_1485 copA -80 6 ACTCTCCCATTAGGGGAGACA
Shewanella woodyi ATCC 51908
Swoo_3192 cueR -60 5.8 TGTCTCCCCTTATGGGAGGGT
Swoo_3191 copA -81 5.8 ACCCTCCCATAAGGGGAGACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD