Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR2 in Shewanellaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR2 - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella putrefaciens CN-32
Sputcn32_0271 cueR2 -66 6.1 AGCTGTGTGTTACACACAGAG
Shewanella frigidimarina NCIMB 400
Sfri_0211 cueR2 -101 6 ACATGGGTGTAAGACATAGGT
Shewanella loihica PV-4
Shew_3819 cueR2 -66 6.8 ACCTGTGTCTAACACACAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD