Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CalR in Shewanellaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Utilization of aromatic compounds
Effector:
Regulog: CalR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_3683 calB -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella putrefaciens CN-32
Sputcn32_2982 calB -104 6.9 AACCGACTAATCAGTCGGTA
Shewanella sp W3-18-1
Sputw3181_0965 calB -104 6.9 AACCGACTAATCAGTCGGTA
Shewanella sp ANA-3
Shewana3_3251 calB -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella sp MR-4
Shewmr4_0872 calB -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella sp MR-7
Shewmr7_3150 calB -78 7.2 AACCGACTAATCAGTCGGTT
Shewanella baltica OS155
Sbal_3332 calB -125 6.9 AACCGACTAATCAGTCGGTA
Shewanella denitrificans OS217
Sden_0975 calB -45 6.8 ACCCGACTGATTAGTCGGTT
Shewanella frigidimarina NCIMB 400
Sfri_0937 calB -82 7.1 GACCGACTAATCAGTCGGTT
Shewanella amazonensis SB2B
Sama_2855 calB -43 7.1 GACCGACTAATCAGTCGGTT
Shewanella loihica PV-4
Shew_3103 calB -127 7.1 GACCGACTAATCAGTCGGTT
Shewanella pealeana ATCC 700345
Spea_3357 calB -49 7.1 GACCGACTAATCAGTCGGTT
Shewanella halifaxensis HAW-EB4
Shal_3429 calB -49 7 GACCGACTAATCAGTCGGTC
Shewanella piezotolerans WP3
swp_1052 calB -50 7.1 GACCGACTAATCAGTCGGTT
Shewanella sediminis HAW-EB3
Ssed_3716 calB -203 7.1 GACCGACTAATCAGTCGGTT
Shewanella woodyi ATCC 51908
Swoo_4064 calB -77 6.6 GACCGACCAATCAGTCGGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD