Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EbgR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: EbgR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_0204 ebgR -89 4.9 GTTTCTTTTAGTAAAAATGCT
AHA_0205 ebgA -326 4.9 GCTGATTTTAGTAAAATAATC
AHA_0205 ebgA -65 4.8 CTGATATTTAGTAAATGTTTA
Psychromonas sp. CNPT3
PCNPT3_06111 ebgR -87 5.4 CTAAGTTTTAGTAAAAAACAT
PCNPT3_06111 ebgR -49 4.7 AAATAATTCAGTAATATATAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD