Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EbgR in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: EbgR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Photobacterium profundum SS9
PBPRA2084 ebgA -53 4.2 AAAACTTTAACTAACATAGCT
PBPRA2084 ebgA -65 5.9 ATTTATTTTACTAAAACTTTA
PBPRA2083 ebgR -191 5.3 GATAATTTTACTAAAACATCA
PBPRA2084 ebgA -332 5.5 TTGTATTTTACTAAAATTTAA
PBPRA2084 ebgA -78 4.3 AACAGATTTACCAATTTATTT
Vibrio angustum S14
VAS14_15114 ebgA -118 4.3 AACGTTTTCACTAATTTATTT
VAS14_15114 ebgA -93 5.7 AAAACTTTTACTAAAATCGTT
VAS14_15114 ebgA -105 6.1 ATTTATTTTAGTAAAACTTTT
VAS14_15119 ebgR -109 5.7 AAAGTTTTTACTAAAAAAATT
VAS14_15119 ebgR -159 4.6 ATATTTATTATTATATTTTTT
VAS14_15119 ebgR -162 4.5 AATATATTTATTATTATATTT
Vibrio fischeri ES114
VF_A0338 SSF48208 -45 5.5 GTTAAATTTAGTAAAACTTTA
VF_A0340 ygjI -71 5.3 CTATAATTTACTAAAAGTTAC
VF_A0340 ygjI -81 4.9 AAATTAATTACTATAATTTAC
VF_A0340 ygjI -94 5.9 GTAACTTTTAGTAAAATTAAT
VF_A0347 ebgA -67 4.3 GAGTTATTTACTACGATTTAT
VF_A0347 ebgA -96 4.5 TAAAACTTTAGTTAATATCTT
VF_A0347 ebgA -107 5.7 ATTTGTTTTACTAAAACTTTA
VF_A0348 ebgR -92 4.9 TAAAACTTTAGTAAAAGCCAT
Vibrio harveyi ATCC BAA-1116
VIBHAR_03334 ebgR -104 5.4 CACAGTTTTACTAAAAATTTG
Vibrio parahaemolyticus RIMD 2210633
VP2403 ebgA -168 4.3 AACGTTTTCACTAATTTATTT
VP2403 ebgA -155 6.1 ATTTATTTTAGTAAAACTTTT
VP2403 ebgA -143 5.7 AAAACTTTTACTAATATCTTT
VP2402 ebgR -102 5.1 CTCGATTTTACTAAAAGTTTG
Vibrio shilonii AK1
VSAK1_18704 ebgA -98 6.2 ATATATTTTAGTAAAACTTTT
VSAK1_18704 ebgA -86 5.6 AAAACTTTTACTAAAATTACC
VSAK1_18699 ebgR -104 5.1 GCTGTTTTTACTAAAATTTTA
Vibrio vulnificus CMCP6
VV1_1767 ebgA -95 5.9 AAAAGTTTTACTAATATATTT
VV1_1767 ebgA -107 5.2 ATTCTATTTAGTAAAAGTTTT
VV1_1769 ebgR -102 4.3 TCGATTTTTACTAAAAAAACG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD