Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ECA4246 in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: ECA4246 - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4250 ECA4250 -12 6.8 GAATGCACAGCTGTGCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD