Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CD0683 in Clostridia-2

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Regulog: CD0683 - Clostridia-2
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium difficile 630
CD0679 CD0679 -119 6.1 AAATGCATATGTATTCATAA
CD0680 CD0680 -37 6.3 TTATGCATACGTATTCTGAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD