Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BetI in Shewanellaceae

Properties
Regulator family: TetR
Regulation mode: repressor
Biological process: Osmotic stress response
Effector: Betaine
Regulog: BetI - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella baltica OS155
Sbal_1323 betI -63 7 TGGATTGAACGTTCAATTAA
Shewanella denitrificans OS217
Sden_0713 betI -46 7.5 TTAATTGAACGTTCAATTAA
Shewanella frigidimarina NCIMB 400
Sfri_1948 betI -51 7.2 TTAATTGAGCGTTCAATTAA
Shewanella pealeana ATCC 700345
Spea_1009 betI -97 7.3 TTAATTGAACGTTCAATCAA
Shewanella halifaxensis HAW-EB4
Shal_1059 betI -96 7.3 TTAATTGAACGTTCAATCAA
Shewanella sediminis HAW-EB3
Ssed_1773 betT2 -360 7 TTAATTGATCGTTCAATTAA
Ssed_1121 betI -73 7.5 TTAATTGAACGTTCAATTAA
Shewanella woodyi ATCC 51908
Swoo_1198 betI -83 7.5 TTAATTGAACGTTCAATTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD