Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Bpro_5109 in Comamonadaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bpro_5109 - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Polaromonas sp. JS666
Bpro_5109 Bpro_5109 -80 5.7 ACGTGAATACGTATTCACAG
Bpro_5109 Bpro_5109 -26 6 TTATGACTACGTATTCAAAA
Verminephrobacter eiseniae EF01-2
Veis_4515 Bpro_5109 -34 5.8 AAATGACTACGAATACATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD