Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Csal_3216 in Oceanospirillales/Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Csal_3216 - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromohalobacter salexigens DSM 3043
Csal_3216 Csal_3216 -120 7.3 TTTTGGTAGCGCTACCAAAA
Csal_3216 Csal_3216 -78 6.8 TATTGGTAGCGCTACCAGAT
Csal_3215 Csal_3215 -126 6.8 ATCTGGTAGCGCTACCAATA
Csal_3215 Csal_3215 -84 7.3 TTTTGGTAGCGCTACCAAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD