Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AzrR in Shewanellaceae

Properties
Regulator family: [Other]
Regulation mode: repressor
Biological process: Superoxide stress response
Effector: Paraquat
Regulog: AzrR - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_3584 azrR -104 6.5 CTTTATTTAATCTTGTAAAG
SO_3585 azr -62 6.5 CTTTACAAGATTAAATAAAG
Shewanella putrefaciens CN-32
Sputcn32_1018 azrR -66 5.1 GTTTATTTAATCTGTTAAAG
Sputcn32_1018 azrR -104 6.5 CTTTATTTAATCTTGTAAAG
Sputcn32_1017 azr -62 6.5 CTTTACAAGATTAAATAAAG
Sputcn32_1017 azr -100 5.1 CTTTAACAGATTAAATAAAC
Shewanella sp W3-18-1
Sputw3181_3147 azrR -66 5.1 GTTTATTTAATCTGTTAAAG
Sputw3181_3147 azrR -104 6.5 CTTTATTTAATCTTGTAAAG
Sputw3181_3148 azr -62 6.5 CTTTACAAGATTAAATAAAG
Sputw3181_3148 azr -100 5.1 CTTTAACAGATTAAATAAAC
Shewanella sp ANA-3
Shewana3_3176 azrR -104 6.5 CTTTATTTAATCTTGTAAAG
Shewana3_3177 azr -62 6.5 CTTTACAAGATTAAATAAAG
Shewanella sp MR-4
Shewmr4_2998 azrR -104 6.5 CTTTATTTAATCTTGTAAAG
Shewmr4_2999 azr -62 6.5 CTTTACAAGATTAAATAAAG
Shewanella sp MR-7
Shewmr7_3079 azrR -104 6.5 CTTTATTTAATCTTGTAAAG
Shewmr7_3080 azr -62 6.5 CTTTACAAGATTAAATAAAG
Shewanella baltica OS155
Sbal_1011 azrR -67 5.4 GTTTATTTAATCTATTAAAG
Sbal_1011 azrR -105 6.5 CTTTATTTAATCTTGTAAAG
Sbal_1010 azr -62 6.5 CTTTACAAGATTAAATAAAG
Sbal_1010 azr -100 5.4 CTTTAATAGATTAAATAAAC
Shewanella amazonensis SB2B
Sama_2786 azrR -106 6.7 CTTTACTTAATTATGTAAAG
Sama_2787 azr -77 6.7 CTTTACATAATTAAGTAAAG
Shewanella loihica PV-4
Shew_0915 azrR -97 6.6 CTTTATTTAATTTTGTAAAG
Shew_0914 azr -63 6.6 CTTTACAAAATTAAATAAAG
Shewanella pealeana ATCC 700345
Spea_0888 azrR -104 5.6 CTTTACCAAACAAAGTAAAG
Spea_0887 azr -65 5.6 CTTTACTTTGTTTGGTAAAG
Shewanella halifaxensis HAW-EB4
Shal_0940 azrR -92 5.4 CCTTACAAAACAAAGTAAAG
Shal_0939 azr -65 5.4 CTTTACTTTGTTTTGTAAGG
Shewanella piezotolerans WP3
swp_0892 azrR -80 6.3 CTTTACATAATAAAGTAAAG
swp_0891 azr -64 6.3 CTTTACTTTATTATGTAAAG
Shewanella sediminis HAW-EB3
Ssed_0995 azrR -99 6.3 CTTTACTAAATGTTGTAAAG
Ssed_0994 azr -64 6.3 CTTTACAACATTTAGTAAAG
Shewanella woodyi ATCC 51908
Swoo_1048 azrR -104 5.9 CTTTACTAAGTAATGTAAAG
Swoo_1047 azr -63 5.9 CTTTACATTACTTAGTAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD