Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Enterobacteriales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Yersinia pestis KIM
y3570 PF10091 -62 6.7 TTATAGAAACGTTTCTATTG
y3569 bglD -34 6.6 CTAGTGAAACGTTTCTATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD