Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Enterococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Enterococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Enterococcus faecalis V583
EF1232 bglB -39 6.8 TTGTAGAAACGTTTCACTAA
EF1232 bglB -217 6.8 TTGGTGAAACGTTTCTATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD