Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator EF1410 in Enterococcaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: EF1410 - Enterococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Enterococcus faecalis V583
EF1410 EF1410 -119 6.5 AATTGTTATCGTTTACATCT
EF1411 EF1411 -42 6.5 AGATGTAAACGATAACAATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD