Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ABC1167 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: ABC1167 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus clausii KSM-K16
ABC1168 ABC1168 -35 6.8 TTTTGAATACGTATGCAAGA
ABC1168 ABC1168 -71 6.7 CATTGCATACGTATGCAAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD