Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BC5402 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Regulog: BC5402 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus cereus ATCC 14579
BC5402 BC5402 -54 6.5 TTGTGGAAAGCTTACCAGGT
BC5403 BC5403 -63 6.5 ACCTGGTAAGCTTTCCACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD