Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BC0230 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Regulog: BC0230 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus cereus ATCC 14579
BC0231 BC0231 -105 6.3 ACAGGAAACGCGTTTCATAC
BC2618 BC2618 -114 6.2 ACCTGAAACGCTTTTCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD