Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator PhnR1 in Enterobacteriales

Properties
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Regulog: PhnR1 - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Serratia proteamaculans 568
Spro_4489 phnR1 -162 6.1 TGGCTGGACTAGTCCAGCAA
Spro_4488 phnS -49 6.1 TTGCTGGACTAGTCCAGCCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD