Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CueR in Comamonadaceae

Properties
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_0033 copZ -110 4.9 CCCCTGACATCATGGCAAGGT
Aave_0034 copA -34 4.9 ACCTTGCCATGATGTCAGGGG
Acidovorax sp. JS42
Ajs_0018 copZ -140 5 ACCCTGACATGCTGGCAAGGT
Ajs_1372 copA2 -64 5.3 ACCTTCCCACGATGGTAAGCC
Ajs_1368 copZ2 -65 5.1 ACCTTCCCACCGTGACAAGGC
Ajs_0019 copA -58 5 ACCTTGCCAGCATGTCAGGGT
Comamonas testosteroni KF-1
CtesDRAFT_3915 copZ -80 4.9 ACCTTGTCATGATGTTAGGGT
Delftia acidovorans SPH-1
Daci_0035 copZ -77 5.3 ACCTTGCCATGGTGTCAGGGT
Daci_5724 copA2 -58 4.9 ACCTTGACATGGTGGCAATCT
Methylibium petroleiphilum PM1
Mpe_A1644 null -81 5.3 ACCTTCCCACGTTGTCAAGGT
Mpe_A1640 copA -59 4.8 ACCTTGCCATCGTTAGAACCT
Mpe_A3536 copZ2 -61 5.5 ACCTTCCCACCGGGGCAACGT
Mpe_A3535 copA -34 5.7 ACTTTGCCATGATGGGAAGGT
Mpe_A1641 copZ2 -57 5.2 ACCTTCCAACAGTAGGAGGGT
Polaromonas naphthalenivorans CJ2
Pnap_4089 copZ2 -67 5.5 ACTTTGCCACCGTGGGAAGGT
Pnap_4090 copA -82 5.7 ACCCTGCCATGATGGCAAGGT
Polaromonas sp. JS666
Bpro_3497 copZ2 -26 5 ACCTTCCCACAGTCGGAAGCA
Bpro_4871 copZ2 -218 5.6 ACCCTGCCCCCGTGGGAAGGT
Bpro_4872 copA -84 5.7 ACCCTGCCATGATGGTAAGGT
Bpro_3496 copA -72 5.4 ACTTTCCAACAGTGGCAAGGT
Rhodoferax ferrireducens DSM 15236
Rfer_0024 copA -35 5.8 ACCTTGCCATGATGGGAAGGA
Rfer_0023 cueR 12 6 ACCTTCCCACGGTGGCAAGGT
Variovorax paradoxus S110
Vapar_0031 copA -34 4.8 ACCTTGCCATGATGTGAGACT
Vapar_2999 cueR2 -60 4.6 ACTCTCCCATGGTGTGAAGGC
Vapar_0030 copZ -70 4.9 ACATTGACATCATGAGAAGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD