Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Jk1423 in Corynebacteriaceae

Properties
Regulator family: TetR
Regulation mode: repressor (activator)
Biological process:
Effector:
Regulog: Jk1423 - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium aurimucosum ATCC 700975
cauri_1677 jk1421 -100 6.2 TTAGAAACATAGTGTTGCCAT
cauri_1677 jk1421 -78 6 ATAGAAACAGAATGTTTCTAT
Corynebacterium jeikeium K411
jk1421 jk1421 -82 6 TTGGCAACACATCGTTGCTAA
jk1421 jk1421 -104 6 TTAGAAACACCCTGTTTTTAT
Corynebacterium urealyticum DSM 7109
cur_0150 jk1421 -104 6.4 TTGGCAACACGGTGTTGCTAA
cur_0150 jk1421 -126 5.6 TTGGCAACGCCTTGTTTTCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD