Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cg2314 in Corynebacteriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Cg2314 - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium glutamicum ATCC 13032
cg2314 cg2314 -95 6.4 CTACTATAACGTTCTAGTAG
cg2313 cg2313 -51 6.4 CTACTAGAACGTTATAGTAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD