Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator LexA in Shewanellaceae

Properties
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Shewanellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Shewanella oneidensis MR-1
SO_3430 recA -127 5.6 TACTGTATGATTGTACAGTA
SO_2604 yebG -31 6 TACTGTATATAAAAACAGTG
SO_3462 recN -72 5.8 TACTGTATATAAAATCAGTA
SO_3462 recN -50 5.6 TACTGTTTATCAATACAGTG
SO_3061 topB -32 5.7 TACTGTAATTATATCCAGTA
SO_4603 lexA -45 5.9 TACTGTATATACTAACAGTA
SO_4603 lexA -26 5 AACTGTATAGAAAAACAGGA
SO_1114 dinB -44 5.9 AACTGTTTTTATATACAGTA
SO_1819 dinG -43 5.4 CACTGTTATTATGTACAGCA
SO_A0013 umuD -32 5.6 AACTGTATATTTATACAGTT
SO_4364 recG -45 4.3 ATATGTATAAATTCACAGTG
SO_2037 xerD -39 5.5 TACTGTATAAAATTACAGCG
Shewanella putrefaciens CN-32
Sputcn32_2747 recA -129 5.6 TACTGTATGATTGTACAGTA
Sputcn32_2205 yebG -30 6 TACTGTATATAAAAACAGTG
Sputcn32_3780 lexA -45 5.9 TACTGTATATACTAACAGTA
Sputcn32_3780 lexA -26 5 AACTGTATAGAAAAACAGGA
Sputcn32_2435 topB -32 5.6 TACTGTAATTATATCCAGTG
Sputcn32_0951 dinB 20 5.7 TACTGGTTTTATATACAGTA
Sputcn32_2771 recN -50 5.6 TACTGTTTATCAATACAGTG
Sputcn32_2771 recN -72 5.8 TACTGTATATAAAATCAGTA
Sputcn32_1513 dinG -43 5.4 CACTGTTATTATGTACAGCA
Sputcn32_0175 umuD -32 5.4 AACTGTATATTTGTACAGTT
Sputcn32_0450 recG -21 4.3 ATATGTATAAATTCACAGTG
Shewanella sp W3-18-1
Sputw3181_0135 lexA -26 5 AACTGTATAGAAAAACAGGA
Sputw3181_1804 yebG -30 6 TACTGTATATAAAAACAGTG
Sputw3181_0135 lexA -45 5.9 TACTGTATATACTAACAGTA
Sputw3181_1573 topB -32 5.6 TACTGTAATTATATCCAGTG
Sputw3181_1265 recA -129 5.6 TACTGTATGATTGTACAGTA
Sputw3181_3225 dinB -43 5.7 TACTGGTTTTATATACAGTA
Sputw3181_1241 recN -72 5.8 TACTGTATATAAAATCAGTA
Sputw3181_1241 recN -50 5.6 TACTGTTTATCAATACAGTG
Sputw3181_2587 dinG -43 5.4 CACTGTTATTATGTACAGCA
Sputw3181_0304 recG -21 4.3 ATATGTATAAATTCACAGTG
Sputw3181_2904 ogr -63 5.3 TACTGTTTAAAAACACAGTG
Sputw3181_1083 umuD -46 5.9 TACTGTATAAACAAACAGTA
Shewanella sp ANA-3
Shewana3_1126 recA -128 5.6 TACTGTATGATTGTACAGTA
Shewana3_1486 topB -32 5.4 CACTGTAATTATATCCAGTG
Shewana3_1775 yebG -31 6 TACTGTATATAAAAACAGTG
Shewana3_1104 recN -72 5.9 TACTGTATATAAATTCAGTA
Shewana3_1104 recN -50 5.6 TACTGTTTATCAATACAGTG
Shewana3_3989 lexA -45 5.9 TACTGTATATACTAACAGTA
Shewana3_3989 lexA -26 5 AACTGTATAGAAAAACAGGA
Shewana3_0949 dinB -44 6.1 TACTGTTTTTATATACAGTA
Shewana3_2630 dinG -43 5.4 CACTGTTATTATGTACAGCA
Shewana3_0348 recG -21 4.3 ATATGTATAAATTCACAGTG
Shewana3_1833 umuD 14 6 TACTGTATTTACATACAGTA
Shewana3_4173 umuD -23 5.9 TACTGTATTAATGTACAGTA
Shewanella sp MR-4
Shewmr4_1670 yebG -31 6 TACTGTATATAAAAACAGTG
Shewmr4_1104 recN -72 5.9 TACTGTATATAAATTCAGTA
Shewmr4_1104 recN -50 5.6 TACTGTTTATCAATACAGTG
Shewmr4_1433 topB -32 5.6 CACTGTAATTATATCCAGTA
Shewmr4_1125 recA -128 5.6 TACTGTATGATTGTACAGTA
Shewmr4_3789 lexA -45 5.9 TACTGTATATACTAACAGTA
Shewmr4_3789 lexA -26 5 AACTGTATAGAAAAACAGGA
Shewmr4_0947 dinB -44 6.1 TACTGTTTTTATATACAGTA
Shewmr4_2470 dinG -43 5.4 CACTGTTATTATGTACAGCA
Shewmr4_0354 recG -21 4.3 ATATGTATAAATTCACAGTG
Shewmr4_1782 umuD 14 6 TACTGTACTTATATACAGTA
Shewanella sp MR-7
Shewmr7_1196 recA -128 5.6 TACTGTATGATTGTACAGTA
Shewmr7_1170 recN -72 5.9 TACTGTATATAAATTCAGTA
Shewmr7_1170 recN -50 5.6 TACTGTTTATCAATACAGTG
Shewmr7_1745 yebG -31 6 TACTGTATATAAAAACAGTG
Shewmr7_1498 topB 30 5.6 CACTGTAATTATATCCAGTA
Shewmr7_3862 lexA -45 5.9 TACTGTATATACTAACAGTA
Shewmr7_3862 lexA -26 5 AACTGTATAGAAAAACAGGA
Shewmr7_0985 dinB -44 6.1 TACTGTTTTTATATACAGTA
Shewmr7_2538 dinG -43 5.4 CACTGTTATTATGTACAGCA
Shewmr7_3672 recG -21 4.3 ATATGTATAAATTCACAGTG
Shewmr7_2195 umuD 14 6.2 TACTGTATTTATATACAGTA
Shewmr7_0718 ogr -82 5.9 TACTGTTTAAAAAAACAGTA
Shewmr7_2132 xerD -39 5.4 TACTGTATAAAACAACAGTA
Shewanella baltica OS155
Sbal_2450 yebG -31 6 TACTGTATATAAAAACAGTG
Sbal_2736 topB -32 5.6 TACTGTAATTATATCCAGTG
Sbal_3117 recA -127 5.6 TACTGTATGATTGTACAGTA
Sbal_0156 lexA -26 5 AACTGTATAGAAAAACAGGA
Sbal_0156 lexA -45 5.9 TACTGTATATACTAACAGTA
Sbal_0935 dinB -43 6.1 TACTGTTTTTATATACAGTA
Sbal_3153 recN -72 5.8 TACTGTATATAAAATCAGTA
Sbal_3153 recN -50 5.6 TACTGTTTATCAATACAGTG
Sbal_1629 dinG -43 5.4 CACTGTTATTATGTACAGCA
Sbal_3554 umuD -30 5.6 TGCTGTATATAATTACAGTG
Sbal_0346 recG -21 4.3 ATATGTATAAATTCACAGTG
Sbal_1278 ogr -63 5.8 CACTGTTTAAAAATACAGTA
Sbal_2352 umuD -34 5.6 TACTGTTCATACGTACAGTA
Shewanella denitrificans OS217
Sden_1151 recN -71 5.4 TACTGTATAAAAAACCAGTG
Sden_1719 yebG -31 6 CACTGTATATAAAAACAGTA
Sden_3515 lexA -45 5.1 TACTGTATATAATGACAGTC
Sden_3515 lexA -26 5.1 CACTGTATAAAAAGACAGGA
Sden_2400 topB -41 5.6 CACTGTAATTACATACAGTG
Sden_1208 recA -203 5.8 TACTGTATGATTATACAGTA
Sden_1185 dinB -52 5.8 CACTGTTTTTTTATACAGTA
Sden_1151 recN -49 5.6 TACTGTTTATCAATACAGTG
Sden_2429 dinG -52 5.4 CACTGTTATTATGTACAGCA
Sden_3476 recG -36 4.8 ATATGTATAAATTTACAGTG
Sden_3236 umuD -29 6 TACTGTATATAATTACAGTG
Sden_1131 xerC -39 5.3 AACTGTATATAAACACAGTG
Shewanella frigidimarina NCIMB 400
Sfri_2231 yebG -31 5.9 CACTGTATATAAAAACAGTG
Sfri_0260 lexA -45 5 CACTGTATATAATGACAGTC
Sfri_0260 lexA -26 5.1 CACTGTATAAAAAGACAGGA
Sfri_1401 topB -67 5.8 TACTGTAAATTTATACAGTT
Sfri_1062 recA -113 5.5 TACTGTATGACTATACAGTA
Sfri_0961 dinB -57 6.1 TACTGTTTTTATATACAGTA
Sfri_1043 recN -50 5.6 TACTGTTTATCAATACAGTG
Sfri_1043 recN -72 5.8 TACTGTATATAAAATCAGTA
Sfri_2630 dinG -51 5.4 CACTGTTATTATGTACAGCA
Sfri_1963 umuD -58 5.9 TACTGTTTATTTATACAGTG
Sfri_1963 umuD -43 4.8 CAGTGTGTTTTTATACAGTA
Sfri_0356 recG -47 5.3 ATCTGTATATAATTACAGTG
Shewanella amazonensis SB2B
Sama_1026 recN -73 5.4 TACTGTACAAAAAATCAGTA
Sama_1026 recN -51 5.3 TACTGTGTATCAATACAGTA
Sama_2145 topB 29 5.3 TACTGTAAATTCATCCAGTG
Sama_1046 recA -115 5.6 TACTGTATGATTGTACAGTA
Sama_1249 dinG -42 5.4 CACTGTTATTATGTACAGCA
Sama_1582 yebG -31 5.8 CACTGTATAAATAAACAGTG
Sama_3481 lexA -45 5.6 TACTGTATATACTGACAGTA
Sama_3481 lexA -26 5 AACTGTATAGAAAAACAGGA
Sama_2527 dinB -36 6.1 TACTGTTTTTATATACAGTA
Sama_3375 recG -36 4.4 ATATGTATAAATTCACAGTA
Sama_1865 imuA -66 5.9 TACTGTATAAATATACAGTT
Sama_1355 xerD -38 5.9 TACTGTTTTTATATACAGTT
Sama_1633 xerD -34 5.4 CACTGTACGTACATACAGTT
Shewanella loihica PV-4
Shew_1196 recN -62 5.7 TACTGTATAAAAATTCAGTA
Shew_1196 recN -40 4.9 TACTGTGCATGAATACAGTA
Shew_2299 topB -32 5.9 TACTGTTAATTTATACAGTA
Shew_1799 yebG -31 5.7 AACTGTATATAAAAACAGTG
Shew_1215 recA -127 5.6 TACTGTATGATTGTACAGTA
Shew_0127 lexA -45 4.9 TACTGTATATACTGACAGGT
Shew_0127 lexA -26 4.8 TACTGTATGGAAAGACAGGA
Shew_2871 dinB -43 5.9 TACTGTTTAAATGTACAGTA
Shew_2483 dinG -43 5.4 CACTGTTATTATGTACAGCA
Shew_3507 recG -71 5.1 ATATGTATATATTTACAGTA
Shew_2102 imuA -145 6.1 TACTGTATTTATATACAGTG
Shew_3147 xerC -299 5.5 CGCTGTTTATTTATACAGTG
Shewanella pealeana ATCC 700345
Spea_1169 recN -40 5.3 TACTGTTTAACCATACAGTG
Spea_3092 dinB -44 6.1 TACTGTTTTTATATACAGTA
Spea_1169 recN -62 5.9 TACTGTATGAATAAACAGTA
Spea_1625 topB -36 5.9 TACTGTTAATTTATACAGTA
Spea_1932 yebG -31 5.9 CACTGTATATAAAAACAGTG
Spea_1195 recA -124 5.6 TACTGTATGATTGTACAGTA
Spea_3997 lexA -45 5.2 TACTGTATATACTAACAGGT
Spea_3997 lexA -26 4.9 TACTGTATAGAAAGACAGGG
Spea_2656 dinG -43 5.4 CACTGTTATTATGTACAGCA
Spea_2196 umuD -34 5.7 TACTGTATAAACATACAGTT
Spea_3884 recG -21 4.8 ATATGTATAAATTTACAGTG
Spea_2629 xerC -100 5.3 AACTGTATGTATATACAGCT
Shewanella halifaxensis HAW-EB4
Shal_1212 recN -62 5.8 TACTGTATAGATAAACAGTA
Shal_1212 recN -40 5.5 TACTGTTTAACTATACAGTG
Shal_2636 topB -36 5.9 TACTGTTAATTTATACAGTA
Shal_1232 recA -124 5.6 TACTGTATGATTGTACAGTA
Shal_3176 dinB -44 6.1 TACTGTTTTTATATACAGTA
Shal_2367 yebG -31 6 TACTGTATATAAAAACAGTG
Shal_0260 lexA -45 4.9 TACTGTATATACTGACAGGT
Shal_0260 lexA -26 4.9 TACTGTATAGAAAGACAGGG
Shal_2730 dinG -43 5.4 CACTGTTATTATGTACAGCA
Shal_2184 umuD -34 5.9 TACTGTATAAAAATACAGTG
Shal_2170 umuD -35 5.7 TACTGTACAAATATACAGTT
Shal_0385 recG -21 4.8 ATATGTATAAATTTACAGTG
Shal_1316 ogr -63 5.3 TACTGTTCAAAAACACAGTA
Shal_1634 xerC -35 5.7 TACTGTATAGATAAACAGTG
Shewanella piezotolerans WP3
swp_1346 recN -61 5.7 TACTGTATAGAAAAACAGTA
swp_1346 recN -39 5.6 TACTGTTTATCAATACAGTG
swp_3111 topB -36 5.8 TACTGTTAATTTATACAGTG
swp_2821 yebG 11 6 TACTGTATATAAAAACAGTG
swp_1366 recA -123 5.6 TACTGTATGATTGTACAGTA
swp_4821 lexA -45 5.2 TACTGTATATACTAACAGGT
swp_4821 lexA -26 5 TACTGTATAGAAAAACAGGT
swp_1179 dinB -95 6.1 TACTGTTTTTATATACAGTA
swp_3212 dinG -10 5.4 CACTGTTATTATGTACAGCA
swp_0309 recG -21 4.8 ATATGTATAAATTTACAGTG
Shewanella sediminis HAW-EB3
Ssed_1281 recN -40 5.5 TACTGTTTAAAAACACAGTA
Ssed_1300 recA -135 5.6 TACTGTATGATTGTACAGTA
Ssed_2486 yebG -31 5.9 AACTGTATATAAAAACAGTA
Ssed_0200 lexA -45 5.6 TACTGTATATACTAACAGTT
Ssed_1281 recN -62 5.8 TACTGTATATAAAATCAGTA
Ssed_1658 topB -38 5.4 TACTGGTAATTTATACAGTG
Ssed_0200 lexA -26 5 TACTGTATAGAAAGACAGGA
Ssed_3422 dinB -56 6 TACTGTTTAAATATACAGTA
Ssed_1566 dinG -36 5.1 CACTGTTATTATGTACAGCT
Ssed_2172 umuD -39 6.1 TACTGTATATTTATACAGTA
Ssed_0329 recG -71 4.5 ATATGTATATAAACACAGTG
Shewanella woodyi ATCC 51908
Swoo_3340 recA -124 5.5 TACTGTATGACTATACAGTA
Swoo_3359 recN -64 5.9 TACTGTATTTATGAACAGTA
Swoo_3359 recN -42 5.9 TACTGTTCATAAATACAGTA
Swoo_2976 topB -35 5.4 TACTGGTAATTTATACAGTG
Swoo_0180 lexA -26 5 TACTGTATAGAAAGACAGGA
Swoo_3604 dinB -52 6 CACTGTTTTTATATACAGTA
Swoo_2130 yebG -31 5.9 AACTGTATATAAAAACAGTA
Swoo_0180 lexA -45 5.3 TACTGTATATACTGACAGTT
Swoo_3086 dinG -37 5.1 CACTGTTATTATGTACAGCT
Swoo_2465 umuD -38 5.3 TACTGTATAAAAACACAGTT
Swoo_4592 recG -68 5 ATATGTATATAAATACAGTG
Swoo_4307 xerD -48 5.8 CACTGTTTTTTTATACAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD