Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR2 in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_1786 fruB -169 4.9 ATCCGCAATCGTTTCCACTG
RSP_1786 fruB -60 5.5 TGGTGGAAACGTTTCCACAT
RSP_1785 fruR2 -127 5.5 ATGTGGAAACGTTTCCACCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD