Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Atu5239 in Rhizobiales

Properties
Regulator family: LacI
Regulation mode:
Biological process:
Effector:
Regulog: Atu5239 - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Agrobacterium tumefaciens str. C58 (Cereon)
Atu5233 dsd -64 6.3 TAATGACAACGTTACCATCA
Atu5232 COG0251 -88 6.3 TGATGGTAACGTTGTCATTA
Atu5233 dsd -27 6.1 CAATGACAACGATACCATCG
Atu5232 COG0251 -125 6.1 CGATGGTATCGTTGTCATTG
Bradyrhizobium japonicum USDA 110
bll3981 dsd -67 6.2 TAATGACAACGTTGTCATTC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD