Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR3 in Caulobacterales

Properties
Regulator family: LacI
Regulation mode:
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Regulog: BglR3 - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC2315 bglT -200 5.8 TCGCGGCGACGTCGTAGATC
CC2316 bglR3 14 5.8 GATCTACGACGTCGCCGCGA
Caulobacter segnis ATCC 21756
Cseg_3094 bglT -252 6.1 GCGCGGCGACGTCGTAGATC
Cseg_3095 bglR3 14 6.1 GATCTACGACGTCGCCGCGC
Caulobacter sp. K31
Caul_3554 bglT -249 5.6 GCGCCGCCACGTCATAGATC
Caul_3555 bglR3 14 5.6 GATCTATGACGTGGCGGCGC
Phenylobacterium zucineum HLK1
PHZ_c2928 bglT -131 6 GCTCCGCCACGTCGTAGATC
PHZ_c2927 bglR3 14 6 GATCTACGACGTGGCGGAGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD